| choosebank {seqinr} | R Documentation |
This function allows to select one of the databases structured under ACNUC and located on the web.
Called without arguments, choosebank(), will return the list of available databases.
Then, you can use query to make your query and get a list of sequence names.
Remote access to ACNUC databases works by opening a socket connection on a port (for example
on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol
described in the section references.
choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
timeout = 5, infobank = FALSE, tagbank = NA)
bank |
string. The name of the bank. If NA, |
host |
string. Host name for port (see |
port |
integer. The TCP port number (see |
server |
logical. Should the socket be a client or a server? (see |
blocking |
logical. (see |
open |
string. A description of how to open the connection (see |
encoding |
string. The name of the encoding to be used. (see |
verbose |
logical. If TRUE, verbose mode is on |
timeout |
integer. The timeout in seconds for |
infobank |
logical. If |
tagbank |
string. If |
When called without arguments, choosebank() returns a list of all the databases names known
by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame
with more information is returned.
When called with a regular bank name, an (invisible) list with 6 components:
socket |
an object of class |
bankname |
the name of the bank |
banktype |
the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF) |
totseqs |
the total number of sequences present in the opened database |
totspecs |
the total number of species present in the opened database |
totkeys |
the total number of keywords present in the opened database |
When called with bank = NA:
|
A vector of all available bank names. |
When called with bank = NA and infobank = TRUE, a data.frame with three columns:
bank |
The name of the bank. |
status |
The bank status (on/of). |
info |
Short description of bank with last release date. |
The invisible list returned when a database is opened is stored in the variable
banknameSocket in the global environment.
D. Charif, J.R. Lobry
For more information about the socket communication protocol with ACNUC please get at http://doua.prabi.fr/databases/acnuc/remote_acnuc.html.
To get the release date and content of all the databases located at the pbil, please look at the following url: http://doua.prabi.fr/search/releases
Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system.
Nucl. Acids Res., 12:121-127.
Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985)
ACNUC - a portable retrieval system for nucleic acid sequence databases:
logical and physical designs and usage.
Comput. Appl. Biosci., 3:167-172.
Gouy, M., Gautier, C., Milleret, F. (1985) System analysis and nucleic acid sequence banks.
Biochimie, 67:433-436.
citation("seqinr")
where.is.this.acc if you have a sequence accession number but you
don't know which database to open, query to make a query when a database
is opened, connection, socketConnection
## Not run: # Need internet connection
# Show available databases:
choosebank()
# Show frozen databases:
choosebank(tag = "TP")
# Select a database:
choosebank("emblTP", tag = "TP")
# Do something with the database:
myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
# Close the database:
closebank()
## End(Not run)