------  ASN.1 file format -----------

ASN.1 -- see NCBI toolkit docs, source and examples (ncbi.nlm.nih.gov)

Example asn.1 sequence file----

Bioseq-set ::= {
seq-set {
  seq {
    id { local id 1 } ,                 -- id essential
    descr {  title "Dummy sequence data from nowhere"  } ,  -- optional
    inst {                              -- inst essential
      repr raw ,
      mol dna ,
      length 156 ,
      topology linear ,
      seq-data
        iupacna "GAATTCATTTTTGAAACAAATCGACCTGACGACGGAATGGTACTCGAATTA
TGGGCCAAAGGGTTTTATGGGACAAATTAATAGGTGTTCATTATATGCCACTTTCGGAGATTAGATACAGCAATGCAG
TGGATTCAAAGCAATAGAGTTGTTCTT" 
      } } ,

        seq {
          id { local id 2 } ,
          descr {  title "Dummy sequence 2 data from somewhere else"  } ,
          inst {
                repr raw ,
                mol dna ,
                length 150 ,
                topology linear ,
                seq-data
                  iupacna "TTTTTTTTTTTTGAAACAAATCGACCTGACGACGGAATGGTACTCGAATTA
TGGGCCAAAGGGTTTTATGGGACAAATTAATAGGTGTTCATTATATGCCACTTTCGGAGATTAGATACAGCAATGCAG
TGGATTCAAAGCAATAGAGTT" 
            }
          }
        }
      }

------------------------------------------------

partial ASN.1 description from toolkit

Bioseq-set ::= SEQUENCE {      -- just a collection
    id Object-id OPTIONAL ,
    coll Dbtag OPTIONAL ,          -- to identify a collection
    level INTEGER OPTIONAL ,       -- nesting level
    class ENUMERATED {
        not-set (0) ,
        nuc-prot (1) ,              -- nuc acid and coded proteins
        segset (2) ,                -- segmented sequence + parts
        conset (3) ,                -- constructed sequence + parts
        parts (4) ,                 -- parts for 2 or 3
        gibb (5) ,                  -- geninfo backbone
        gi (6) ,                    -- geninfo
        genbank (7) ,               -- converted genbank
        pir (8) ,                   -- converted pir
        pub-set (9) ,               -- all the seqs from a single publication
        equiv (10) ,                -- a set of equivalent maps or seqs
        swissprot (11) ,            -- converted SWISSPROT
        pdb-entry (12) ,            -- a complete PDB entry
        mut-set (13) ,              -- set of mutations
        pop-set (14) ,              -- population study
        phy-set (15) ,              -- phylogenetic study
	      eco-set (16) ,              -- ecological sample study
        gen-prod-set (17) ,         -- genomic products, chrom+mRNa+protein  
        other (255) } DEFAULT not-set ,
    release VisibleString OPTIONAL ,
    date Date OPTIONAL ,
    descr Seq-descr OPTIONAL ,
    seq-set SEQUENCE OF Seq-entry ,
    annot SET OF Seq-annot OPTIONAL }

Seq-entry ::= CHOICE {
        seq Bioseq ,
        set Bioseq-set } 

Bioseq ::= SEQUENCE {
    id SET OF Seq-id ,            -- equivalent identifiers
    descr Seq-descr OPTIONAL , -- descriptors
    inst Seq-inst ,            -- the sequence data
    annot SET OF Seq-annot OPTIONAL }

SSeq-inst ::= SEQUENCE {            -- the sequence data itself
    repr ENUMERATED {              -- representation class
        not-set (0) ,              -- empty
        virtual (1) ,              -- no seq data
        raw (2) ,                  -- continuous sequence
        seg (3) ,                  -- segmented sequence
        const (4) ,                -- constructed sequence
        ref (5) ,                  -- reference to another sequence
        consen (6) ,               -- consensus sequence or pattern
        map (7) ,                  -- ordered map of any kind
        delta (8) ,              -- sequence made by changes (delta) to others
        other (255) } ,
    mol ENUMERATED {               -- molecule class in living organism
        not-set (0) ,              --   > cdna = rna
        dna (1) ,
        rna (2) ,
        aa (3) ,
        na (4) ,                   -- just a nucleic acid
        other (255) } ,
    length INTEGER OPTIONAL ,      -- length of sequence in residues
    fuzz Int-fuzz OPTIONAL ,       -- length uncertainty
    topology ENUMERATED {          -- topology of molecule
        not-set (0) ,
        linear (1) ,
        circular (2) ,
        tandem (3) ,               -- some part of tandem repeat
        other (255) } DEFAULT linear ,
    strand ENUMERATED {            -- strandedness in living organism
        not-set (0) ,
        ss (1) ,                   -- single strand
        ds (2) ,                   -- double strand
        mixed (3) ,
        other (255) } OPTIONAL ,   -- default ds for DNA, ss for RNA, pept
    seq-data Seq-data OPTIONAL ,   -- the sequence
    ext Seq-ext OPTIONAL ,         -- extensions for special types
    hist Seq-hist OPTIONAL }       -- sequence history

---------------------------------------------------