Metadata-Version: 2.4
Name: ga4gh.vrs
Version: 2.3.1
Summary: GA4GH Variation Representation Specification (VRS) reference implementation
Author-email: Larry Babb <lbabb@broadinstitute.org>, Reece Hart <reecehart@gmail.com>, Andreas Prlic <andreas.prlic@gmail.com>, Alex Wagner <alex.wagner@nationwidechildrens.org>
License: 
                                         Apache License
                                   Version 2.0, January 2004
                                http://www.apache.org/licenses/
        
           TERMS AND CONDITIONS FOR USE, REPRODUCTION, AND DISTRIBUTION
        
           1. Definitions.
        
              "License" shall mean the terms and conditions for use, reproduction,
              and distribution as defined by Sections 1 through 9 of this document.
        
              "Licensor" shall mean the copyright owner or entity authorized by
              the copyright owner that is granting the License.
        
              "Legal Entity" shall mean the union of the acting entity and all
              other entities that control, are controlled by, or are under common
              control with that entity. For the purposes of this definition,
              "control" means (i) the power, direct or indirect, to cause the
              direction or management of such entity, whether by contract or
              otherwise, or (ii) ownership of fifty percent (50%) or more of the
              outstanding shares, or (iii) beneficial ownership of such entity.
        
              "You" (or "Your") shall mean an individual or Legal Entity
              exercising permissions granted by this License.
        
              "Source" form shall mean the preferred form for making modifications,
              including but not limited to software source code, documentation
              source, and configuration files.
        
              "Object" form shall mean any form resulting from mechanical
              transformation or translation of a Source form, including but
              not limited to compiled object code, generated documentation,
              and conversions to other media types.
        
              "Work" shall mean the work of authorship, whether in Source or
              Object form, made available under the License, as indicated by a
              copyright notice that is included in or attached to the work
              (an example is provided in the Appendix below).
        
              "Derivative Works" shall mean any work, whether in Source or Object
              form, that is based on (or derived from) the Work and for which the
              editorial revisions, annotations, elaborations, or other modifications
              represent, as a whole, an original work of authorship. For the purposes
              of this License, Derivative Works shall not include works that remain
              separable from, or merely link (or bind by name) to the interfaces of,
              the Work and Derivative Works thereof.
        
              "Contribution" shall mean any work of authorship, including
              the original version of the Work and any modifications or additions
              to that Work or Derivative Works thereof, that is intentionally
              submitted to Licensor for inclusion in the Work by the copyright owner
              or by an individual or Legal Entity authorized to submit on behalf of
              the copyright owner. For the purposes of this definition, "submitted"
              means any form of electronic, verbal, or written communication sent
              to the Licensor or its representatives, including but not limited to
              communication on electronic mailing lists, source code control systems,
              and issue tracking systems that are managed by, or on behalf of, the
              Licensor for the purpose of discussing and improving the Work, but
              excluding communication that is conspicuously marked or otherwise
              designated in writing by the copyright owner as "Not a Contribution."
        
              "Contributor" shall mean Licensor and any individual or Legal Entity
              on behalf of whom a Contribution has been received by Licensor and
              subsequently incorporated within the Work.
        
           2. Grant of Copyright License. Subject to the terms and conditions of
              this License, each Contributor hereby grants to You a perpetual,
              worldwide, non-exclusive, no-charge, royalty-free, irrevocable
              copyright license to reproduce, prepare Derivative Works of,
              publicly display, publicly perform, sublicense, and distribute the
              Work and such Derivative Works in Source or Object form.
        
           3. Grant of Patent License. Subject to the terms and conditions of
              this License, each Contributor hereby grants to You a perpetual,
              worldwide, non-exclusive, no-charge, royalty-free, irrevocable
              (except as stated in this section) patent license to make, have made,
              use, offer to sell, sell, import, and otherwise transfer the Work,
              where such license applies only to those patent claims licensable
              by such Contributor that are necessarily infringed by their
              Contribution(s) alone or by combination of their Contribution(s)
              with the Work to which such Contribution(s) was submitted. If You
              institute patent litigation against any entity (including a
              cross-claim or counterclaim in a lawsuit) alleging that the Work
              or a Contribution incorporated within the Work constitutes direct
              or contributory patent infringement, then any patent licenses
              granted to You under this License for that Work shall terminate
              as of the date such litigation is filed.
        
           4. Redistribution. You may reproduce and distribute copies of the
              Work or Derivative Works thereof in any medium, with or without
              modifications, and in Source or Object form, provided that You
              meet the following conditions:
        
              (a) You must give any other recipients of the Work or
                  Derivative Works a copy of this License; and
        
              (b) You must cause any modified files to carry prominent notices
                  stating that You changed the files; and
        
              (c) You must retain, in the Source form of any Derivative Works
                  that You distribute, all copyright, patent, trademark, and
                  attribution notices from the Source form of the Work,
                  excluding those notices that do not pertain to any part of
                  the Derivative Works; and
        
              (d) If the Work includes a "NOTICE" text file as part of its
                  distribution, then any Derivative Works that You distribute must
                  include a readable copy of the attribution notices contained
                  within such NOTICE file, excluding those notices that do not
                  pertain to any part of the Derivative Works, in at least one
                  of the following places: within a NOTICE text file distributed
                  as part of the Derivative Works; within the Source form or
                  documentation, if provided along with the Derivative Works; or,
                  within a display generated by the Derivative Works, if and
                  wherever such third-party notices normally appear. The contents
                  of the NOTICE file are for informational purposes only and
                  do not modify the License. You may add Your own attribution
                  notices within Derivative Works that You distribute, alongside
                  or as an addendum to the NOTICE text from the Work, provided
                  that such additional attribution notices cannot be construed
                  as modifying the License.
        
              You may add Your own copyright statement to Your modifications and
              may provide additional or different license terms and conditions
              for use, reproduction, or distribution of Your modifications, or
              for any such Derivative Works as a whole, provided Your use,
              reproduction, and distribution of the Work otherwise complies with
              the conditions stated in this License.
        
           5. Submission of Contributions. Unless You explicitly state otherwise,
              any Contribution intentionally submitted for inclusion in the Work
              by You to the Licensor shall be under the terms and conditions of
              this License, without any additional terms or conditions.
              Notwithstanding the above, nothing herein shall supersede or modify
              the terms of any separate license agreement you may have executed
              with Licensor regarding such Contributions.
        
           6. Trademarks. This License does not grant permission to use the trade
              names, trademarks, service marks, or product names of the Licensor,
              except as required for reasonable and customary use in describing the
              origin of the Work and reproducing the content of the NOTICE file.
        
           7. Disclaimer of Warranty. Unless required by applicable law or
              agreed to in writing, Licensor provides the Work (and each
              Contributor provides its Contributions) on an "AS IS" BASIS,
              WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or
              implied, including, without limitation, any warranties or conditions
              of TITLE, NON-INFRINGEMENT, MERCHANTABILITY, or FITNESS FOR A
              PARTICULAR PURPOSE. You are solely responsible for determining the
              appropriateness of using or redistributing the Work and assume any
              risks associated with Your exercise of permissions under this License.
        
           8. Limitation of Liability. In no event and under no legal theory,
              whether in tort (including negligence), contract, or otherwise,
              unless required by applicable law (such as deliberate and grossly
              negligent acts) or agreed to in writing, shall any Contributor be
              liable to You for damages, including any direct, indirect, special,
              incidental, or consequential damages of any character arising as a
              result of this License or out of the use or inability to use the
              Work (including but not limited to damages for loss of goodwill,
              work stoppage, computer failure or malfunction, or any and all
              other commercial damages or losses), even if such Contributor
              has been advised of the possibility of such damages.
        
           9. Accepting Warranty or Additional Liability. While redistributing
              the Work or Derivative Works thereof, You may choose to offer,
              and charge a fee for, acceptance of support, warranty, indemnity,
              or other liability obligations and/or rights consistent with this
              License. However, in accepting such obligations, You may act only
              on Your own behalf and on Your sole responsibility, not on behalf
              of any other Contributor, and only if You agree to indemnify,
              defend, and hold each Contributor harmless for any liability
              incurred by, or claims asserted against, such Contributor by reason
              of your accepting any such warranty or additional liability.
        
           END OF TERMS AND CONDITIONS
        
           APPENDIX: How to apply the Apache License to your work.
        
              To apply the Apache License to your work, attach the following
              boilerplate notice, with the fields enclosed by brackets "[]"
              replaced with your own identifying information. (Don't include
              the brackets!)  The text should be enclosed in the appropriate
              comment syntax for the file format. We also recommend that a
              file or class name and description of purpose be included on the
              same "printed page" as the copyright notice for easier
              identification within third-party archives.
        
           Copyright [yyyy] [name of copyright owner]
        
           Licensed under the Apache License, Version 2.0 (the "License");
           you may not use this file except in compliance with the License.
           You may obtain a copy of the License at
        
               http://www.apache.org/licenses/LICENSE-2.0
        
           Unless required by applicable law or agreed to in writing, software
           distributed under the License is distributed on an "AS IS" BASIS,
           WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
           See the License for the specific language governing permissions and
           limitations under the License.
        
Project-URL: Homepage, https://github.com/ga4gh/vrs-python
Project-URL: Documentation, https://github.com/ga4gh/vrs-python
Project-URL: Changelog, https://github.com/ga4gh/vrs-python/releases
Project-URL: Source, https://github.com/ga4gh/vrs-python
Project-URL: Bug Tracker, https://github.com/ga4gh/vrs-python/issues
Keywords: bioinformatics,ga4gh,genomics,hgvs,spdi,variation
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Healthcare Industry
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved :: Apache Software License
Classifier: Operating System :: OS Independent
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Classifier: Programming Language :: Python :: 3.13
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Medical Science Apps.
Requires-Python: >=3.10
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: pydantic~=2.1
Requires-Dist: bioutils
Requires-Dist: requests
Requires-Dist: canonicaljson
Requires-Dist: typing-extensions
Provides-Extra: extras
Requires-Dist: psycopg2-binary; extra == "extras"
Requires-Dist: biocommons.seqrepo>=0.5.1; extra == "extras"
Requires-Dist: bioutils>=0.5.2; extra == "extras"
Requires-Dist: hgvs<2.0,>=1.5.5; extra == "extras"
Requires-Dist: dill~=0.3.7; extra == "extras"
Requires-Dist: click; extra == "extras"
Requires-Dist: pysam==0.23.0; extra == "extras"
Provides-Extra: dev
Requires-Dist: pytest; extra == "dev"
Requires-Dist: pytest-cov; extra == "dev"
Requires-Dist: pytest-vcr; extra == "dev"
Requires-Dist: vcrpy>=7.0.0; extra == "dev"
Requires-Dist: pyyaml; extra == "dev"
Requires-Dist: pre-commit>=4.0.1; extra == "dev"
Requires-Dist: ruff==0.9.4; extra == "dev"
Requires-Dist: sphinx; extra == "dev"
Requires-Dist: sphinx_rtd_theme; extra == "dev"
Provides-Extra: notebooks
Requires-Dist: jupyter; extra == "notebooks"
Requires-Dist: pyyaml; extra == "notebooks"
Dynamic: license-file

# vrs-python

**VRS-Python** provides Python language support and a reference implementation for the
[GA4GH Variation Representation Specification(VRS)](https://github.com/ga4gh/vrs).

## Information

[![license](https://img.shields.io/badge/license-Apache-green)](https://github.com/ga4gh/vrs-python/blob/main/LICENSE) [![binder](https://mybinder.org/badge_logo.svg)](https://mybinder.org/v2/gh/ga4gh/vrs-python/main?labpath=notebooks)

## Releases

[![gitHub tag](https://img.shields.io/github/v/tag/ga4gh/vrs-python.svg)](https://github.com/ga4gh/vrs-python/releases) [![pypi](https://img.shields.io/pypi/v/ga4gh.vrs.svg)](https://pypi.org/project/ga4gh.vrs/) [![DOI](https://zenodo.org/badge/DOI/10.5281/zenodo.14013256.svg)](https://doi.org/10.5281/zenodo.14013256)

## Development

 [![action status](https://github.com/ga4gh/vrs-python/actions/workflows/python-cqa.yml/badge.svg)](https://github.com/ga4gh/vrs-python/actions/workflows/python-cqa.yml) [![issues](https://img.shields.io/github/issues-raw/ga4gh/vrs-python.svg)](https://github.com/ga4gh/vrs-python/issues)
[![GitHub Open Pull Requests](https://img.shields.io/github/issues-pr/ga4gh/vrs-python.svg)](https://github.com/ga4gh/vrs-python/pull/) [![GitHub Contributors](https://img.shields.io/github/contributors/ga4gh/vrs-python.svg)](https://github.com/ga4gh/vrs-python/graphs/contributors/) [![GitHub stars](https://img.shields.io/github/stars/ga4gh/vrs-python.svg?style=social&label=Stars)](https://github.com/ga4gh/vrs-python/stargazers) [![GitHub forks](https://img.shields.io/github/forks/ga4gh/vrs-python.svg?style=social&label=Forks)](https://github.com/ga4gh/vrs-python/forks)

## Features

- Pydantic implementation of GKS core models and VRS models
- Algorithm for generating consistent, globally unique identifiers for variation without a central authority
- Algorithm for performing fully justified allele normalization
- Translating from and to other variant formats
- [Annotate VCFs with VRS](https://github.com/ga4gh/vrs-python/blob/main/docs/extras/vcf_annotator.md)
- Convert GA4GH objects between inlined and referenced forms

## Known Issues

**You are encouraged to** [browse issues](https://github.com/ga4gh/vrs-python/issues).
All known issues are listed there. Please report any issues you find.

## Installing VRS-Python Locally

### Prerequisites

- Python >= 3.10
  - _Note: Python 3.12 is required for developers contributing to VRS-Python. The
    Makefile sets up a virtual environment in `venv/3.12` and expects Python to be
    available as `python3.12`._
- libpq
- postgresql

#### MacOS

You can use Homebrew to install the prerequisites. See the
[Homebrew documentation](https://docs.brew.sh/Installation) for how to install. Make
 sure Homebrew is up-to-date by running `brew update`.

```shell
brew install libpq
brew install python3
brew install postgresql@14
```

#### Ubuntu

```shell
sudo apt install gcc libpq-dev python3-dev
```

### Installation Steps

#### 1. Install VRS-Python with pip

VRS-Python is available on [PyPI](https://pypi.org/project/ga4gh.vrs/).

```shell
pip install 'ga4gh.vrs[extras]'
```

The `[extras]` argument tells pip to install packages to fulfill the dependencies of the
`ga4gh.vrs.extras` package.

#### 2. Install External Data Sources

The `ga4gh.vrs.extras` modules are not part of the VR spec per se. They are
bundled with ga4gh.vrs for development and installation convenience. These
modules depend directly and indirectly on external data sources of sequences,
transcripts, and genome-transcript alignments.

First, you must install a local [SeqRepo](https://github.com/biocommons/biocommons.seqrepo):

```shell
pip install biocommons.seqrepo
export SEQREPO_VERSION=2024-12-20  # or newer if available -- check `seqrepo list-remote-instances`
sudo mkdir -p /usr/local/share/seqrepo
sudo chown $USER /usr/local/share/seqrepo
seqrepo pull -i $SEQREPO_VERSION
seqrepo update-latest
```

If you encounter a permission error similar to the one below:

```shell
PermissionError: [Error 13] Permission denied: '/usr/local/share/seqrepo/2024-12-20._fkuefgd' -> '/usr/local/share/seqrepo/2024-12-20'
```

Try moving data manually with `sudo`:

```shell
sudo mv /usr/local/share/seqrepo/$SEQREPO_VERSION.* /usr/local/share/seqrepo/$SEQREPO_VERSION
```

To make installation easy, we recommend using [Docker](https://docs.docker.com/get-started/get-docker/)
to install the other Biocommons tools - [SeqRepo REST](https://github.com/biocommons/seqrepo-rest-service) and
[UTA](https://github.com/biocommons/uta). If you would like to use local instances of UTA,
see [UTA](https://github.com/biocommons/uta) directly. We do provide some additional
setup help [here](./docs/setup_help/).

Next, run the following commands:

```shell
docker volume create --name=uta_vol
docker volume create --name=seqrepo_vol
docker compose up
```

> [!NOTE]
> You must run all Docker commands from the root of the vrs-python repository (where `docker-compose.yml` lives). See [installing for development](#installing-for-development)
> for the clone commands.
> If you use Docker Compose v1, use `docker-compose` instead of `docker compose`.
> However, we do recommend [upgrading to v2](https://docs.docker.com/compose/releases/migrate/).

This should start three containers:

- [seqrepo](https://github.com/biocommons/seqrepo): downloads seqrepo into a
  docker volume and exits
- [seqrepo-rest-service](https://github.com/biocommons/seqrepo-rest-service): a
  REST service on seqrepo (localhost:5000)
- [uta](https://github.com/biocommons/uta): a database of transcripts and
  alignments (localhost:5432)

Check that the seqrepo-rest-service and uta containers are running, by running:

```shell
$ docker ps
CONTAINER ID        IMAGE                                    //  NAMES
86e872ab0c69        biocommons/seqrepo-rest-service:latest   //  vrs-python_seqrepo-rest-service_1
a40576b8cf1f        biocommons/uta:uta_20241220              //  vrs-python_uta_1
```

Depending on your network and host, the _first_ run is likely to take 5-15
minutes in order to download and install data. Subsequent startups should be
nearly instantaneous.

You can test UTA and seqrepo installations like so:

```shell
$ psql -XAt postgres://anonymous@localhost/uta -c 'select count(*) from uta_20241220.transcript'
314227
curl 'http://127.0.0.1:5000/seqrepo/1/sequence/refseq:NM_000059.4?end=20'
AGAGGCGGAGCCGCTGTGGC
```

##### It doesn't work

Here are some things to try.

- Bring up one service at a time. For example, if you haven't download seqrepo
  yet, you might see this:

  ```shell
  $ docker compose up seqrepo-rest-service
  Starting vrs-python_seqrepo-rest-service_1 ... done
  Attaching to vrs-python_seqrepo-rest-service_1
  seqrepo-rest-service_1  | 2022-07-26 15:59:59 seqrepo_rest_service.__main__[1] INFO Using seqrepo_dir='/usr/local/share/seqrepo/2024-12-20' from command line
  ⋮
  seqrepo-rest-service_1  | OSError: Unable to open SeqRepo directory /usr/local/share/seqrepo/2024-12-20
  vrs-python_seqrepo-rest-service_1 exited with code 1
  ```

- If you are having issues with UTA: if your machine is already running
  postgresql on port 5432 (which is the
  default on many systems), you may see an error message such as this:
  ```shell
  $ psql -XAt postgres://anonymous@localhost/uta -c 'select count(*) from uta_20241220.transcript'
  psql: error: connection to server at "localhost" (::1), port 5432 failed: FATAL:  role "anonymous" does not exist
  ```
  You can move your UTA installation to a different port as follows:
  - Select a new port number for UTA, and verify that the port is available.
    For example, if you have sudo privileges on your machine, you can verify
    the port is available with the `lsof` command:
    ```
    sudo lsof -i :[port_number]
    ```
    If the port is available, the output of this command should be 0 lines long.
  - Edit your docker-compose.yml file.  In the lines
    ```
    ports:
      - 5432:5432
    ```
    replace the *first* number with a different number to specify a port on
    your local machine.
    ````
    ports:
      - [your_port_number]:5432
  - Repeat the `docker compose up` command
  - Repeat the command above to verify that there is now a docker command
    listening at this port.
    ```
    sudo lsof -i :[your_port_number]
    ```
    This time, you should see that a docker command is using the port.
  - Specify the new port in your psql command:
    ```shell
     $ psql -XAt postgres://anonymous@localhost/uta -p [your_port_number] -c 'select count(*) from uta_20241220.transcript'
     ```
  - Set the `UTA_DB_URL` environment variable to specify your port.
    ```shell
    export UTA_DB_URL="postgresql://anonymous@localhost:[your_port_number]/uta/uta_20241220"
    ```

- If you are having issues with SeqRepo, check to see if there is another
  process using port 5000, and try moving to a different port:
  - Follow the instructions above to see if port 5000 is already in use.
  - If it is, edit your docker-compose.yml file to specify a different port.
    In the lines
    ```
    ports:
      - 5000:5000
    ```
    replace the *first* number with a different number to specify a port on
    your local machine.
    ````
    ports:
      - [your_port_number]:5000
  - Repeat the `docker compose up` command
  - Test the SeqRepo REST API service with this new port
    ```shell
    curl 'http://127.0.0.1:[your_port_number]/seqrepo/1/sequence/refseq:NM_000059.4?end=20'
    ```
  - Set the `GA4GH_VRS_DATAPROXY_URI` environment variable to point to
    this UL:
    ```shell
    $ export GA4GH_VRS_DATAPROXY_URI=http://localhost:[your_port_number]/seqrepo
    $ export SEQREPO_URI=http://localhost:[your_port_number]
    ```

## VRS-Python and VRS Version Correspondence

The ga4gh/vrs-python repo embeds the ga4gh/vrs repo as a git submodule for testing purposes.
Each ga4gh.vrs package on PyPI embeds a particular version of VRS. The
correspondences between the packages that are **currently maintained** may be summarized as:

| vrs-python branch | vrs-python tag/version | vrs branch | vrs version |
| --- | --- | --- | --- |
| [main](https://github.com/ga4gh/vrs-python/tree/main) _(default branch)_ | 2.x | [2.x](https://github.com/ga4gh/vrs/tree/2.x) | 2.x |
| [1.x](https://github.com/ga4gh/vrs-python/tree/1.x) | 0.8.x | [1.x](https://github.com/ga4gh/vrs/tree/1.x) | 1.x |

⚠ **Note: Only 2.x branch is being actively maintained. The 1.x branch will only be maintained for bug fixes.**

⚠ **Developers: See the development section below for recommendations for using submodules
gracefully (and without causing problems for others!).**

### Previous VRS-Python and VRS Version Correspondence

The correspondences between the packages that are **no longer maintained** may be summarized as:

| vrs-python branch | vrs-python tag/version | vrs branch | vrs version |
| --- | --- | --- | --- |
| [0.9](https://github.com/ga4gh/vrs-python/tree/0.9) | 0.9.x | [metaschema-update](https://github.com/ga4gh/vrs/tree/metaschema-update) | N/A |
| [0.7](https://github.com/ga4gh/vrs-python/tree/0.7) | 0.7.x | [1.2](https://github.com/ga4gh/vrs/tree/1.2) | 1.2.x |
| [0.6](https://github.com/ga4gh/vrs-python/tree/0.6) | 0.6.x | [1.1](https://github.com/ga4gh/vrs/tree/1.1) | 1.1.x |

## Developers

This section is intended for developers who contribute to VRS-Python.

### Installing for development

[Fork the GitHub repo](https://github.com/ga4gh/vrs-python/fork).

Then, clone your fork and initialize a development environment:

```shell
git clone --recurse-submodules git@github.com:YOUR_GITHUB_ID/vrs-python.git
cd vrs-python
make devready
source venv/3.12/bin/activate
```

This setup includes [pre-commit hooks](https://pre-commit.com/). If you create a virtual environment manually, be sure to install the hooks yourself; otherwise, commits may fail during [CI/CD checks](https://github.com/ga4gh/vrs-python/actions/workflows/python-cqa.yml):

```shell
source venv/3.12/bin/activate
pre-commit install
```

If you already cloned the repo, but forgot to include `--recurse-submodules` you can run:

```shell
git submodule update --init --recursive
```

#### Submodules

vrs-python embeds vrs as a submodule, only for testing purposes. When checking out vrs-python and switching
branches, it is important to make sure that the submodule tracks vrs-python
correctly. The recommended way to do this is `git config --global submodule.recurse true`. **If you don't set submodule.recurse, developers and
reviewers must be extremely careful to not accidentally upgrade or downgrade
schemas with respect to vrs-python.**

Alternatively, see `misc/githooks/`.

### Testing

This package implements typical unit tests for ga4gh.core and ga4gh.vrs. This
package also implements the compliance tests from vrs (vrs/validation) in the
tests/validation/ directory.

To run tests:

```shell
make test
```

## Running the Notebooks

The notebooks **do not** require you to setup SeqRepo or UTA from
[Install External Data Sources](#2-install-external-data-sources).

### Running the Notebooks on Binder

[Binder](https://mybinder.org/) allows you to create custom computing environments that can be shared and used by many remote users.

You can access the notebooks on Binder [here](https://mybinder.org/v2/gh/ga4gh/vrs-python/main?labpath=notebooks).

### Running the Notebooks on the Terra platform

[Terra](https://terra.bio) is a cloud platform for biomedical research developed by the Broad Institute, Microsoft and Verily. The platform includes preconfigured environments that provide user-friendly access to various applications commonly used in bioinformatics, including Jupyter Notebooks.

We have created a public [`VRS-demo-notebooks`](https://app.terra.bio/#workspaces/terra-outreach/VRS-demo-notebooks) workspace in Terra that contains the demo notebooks along with instructions for running them with minimal setup. To get started, see either the [`VRS-demo-notebooks`](https://app.terra.bio/#workspaces/terra-outreach/VRS-demo-notebooks) workspace or the [`Terra.ipynb`](notebooks/Terra.ipynb) notebook in this repository.

### Running the Notebooks with VS Code

[VS Code](https://code.visualstudio.com/) is a code editor developed by Microsoft. It is lightweight, highly customizable, and supports a wide range of programming languages, with a robust extension system. You can download VS Code [here](https://code.visualstudio.com/Download).

1. Open VS Code.
2. Use Extensions view (Ctrl+Shift+X or ⌘+Shift+X) to install the [Jupyter extension](https://marketplace.visualstudio.com/items?itemName=ms-toolsai.jupyter).
3. Navigate to your vrs-python project folder and open it in VS Code.
4. In a notebook, click `Select Kernel` at the top right. Select the option where the path is `venv/3.12/bin/python3`. See [here](https://code.visualstudio.com/docs/datascience/jupyter-kernel-management) for more information on managing Jupyter Kernels in VS Code.
5. After selecting the kernel you can now run the notebook.

## Security Note (from the GA4GH Security Team)

A stand-alone security review has been performed on the specification itself.
This implementation is offered as-is, and without any security guarantees. It
will need an independent security review before it can be considered ready for
use in security-critical applications. If you integrate this code into your
application it is AT YOUR OWN RISK AND RESPONSIBILITY to arrange for a security
audit.
